ID: 928626426_928626428

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 928626426 928626428
Species Human (GRCh38) Human (GRCh38)
Location 2:33144194-33144216 2:33144208-33144230
Sequence CCTAACAGCACAATAGCATCAAG AGCATCAAGAAGGATATAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 179} {0: 1, 1: 0, 2: 2, 3: 32, 4: 316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!