ID: 928654855_928654859

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 928654855 928654859
Species Human (GRCh38) Human (GRCh38)
Location 2:33439948-33439970 2:33439983-33440005
Sequence CCCAATGGAGACACATCTGAGAA TTTTGCAAACTAATTGGGTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 251} {0: 1, 1: 0, 2: 1, 3: 9, 4: 216}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!