ID: 928712300_928712303

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 928712300 928712303
Species Human (GRCh38) Human (GRCh38)
Location 2:34020733-34020755 2:34020772-34020794
Sequence CCACAGAATTATAGAAAGTTGAT CAACAATAAAATACTAATGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 269} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!