ID: 928805181_928805183

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 928805181 928805183
Species Human (GRCh38) Human (GRCh38)
Location 2:35141258-35141280 2:35141297-35141319
Sequence CCATCATCTGTAAAAAACTTAAG AAACAACCCCATTAAAAAGTGGG
Strand - +
Off-target summary No data {0: 1104, 1: 15202, 2: 10476, 3: 6996, 4: 5806}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!