ID: 928847533_928847535

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 928847533 928847535
Species Human (GRCh38) Human (GRCh38)
Location 2:35695668-35695690 2:35695703-35695725
Sequence CCTTGGGTTATTTATTTGAAGGC TTTTTAAATGTAGGCACTTATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 23, 3: 110, 4: 680}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!