ID: 928850011_928850014

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 928850011 928850014
Species Human (GRCh38) Human (GRCh38)
Location 2:35734380-35734402 2:35734396-35734418
Sequence CCCACTGGCTTGGAATTCCAGCT TCCAGCTGGCCAGCAGCAGCAGG
Strand - +
Off-target summary {0: 13, 1: 115, 2: 177, 3: 185, 4: 331} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!