ID: 928914240_928914248

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 928914240 928914248
Species Human (GRCh38) Human (GRCh38)
Location 2:36454868-36454890 2:36454909-36454931
Sequence CCATCTCTGGGATTAAGTAAGTT CAGAAGGAGGATAAAGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 199} {0: 1, 1: 0, 2: 8, 3: 83, 4: 823}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!