ID: 928945092_928945104

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 928945092 928945104
Species Human (GRCh38) Human (GRCh38)
Location 2:36765030-36765052 2:36765078-36765100
Sequence CCCTGGAAAAGATATCCATGTCC CCTTATATGGAAAAAATGTGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 24, 4: 236} {0: 1, 1: 0, 2: 4, 3: 24, 4: 242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!