|
Left Crispr |
Right Crispr |
| Crispr ID |
928980381 |
928980390 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:37130426-37130448
|
2:37130466-37130488
|
| Sequence |
CCCATTCTCCCCACAATACTCCT |
ACCAGATGGCTCCTATAGACTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 3, 2: 3, 3: 23, 4: 255} |
{0: 4, 1: 2, 2: 2, 3: 13, 4: 74} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|