ID: 928980383_928980390

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 928980383 928980390
Species Human (GRCh38) Human (GRCh38)
Location 2:37130434-37130456 2:37130466-37130488
Sequence CCCCACAATACTCCTATTCTCCC ACCAGATGGCTCCTATAGACTGG
Strand - +
Off-target summary {0: 5, 1: 3, 2: 6, 3: 23, 4: 220} {0: 4, 1: 2, 2: 2, 3: 13, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!