ID: 928997356_928997361

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 928997356 928997361
Species Human (GRCh38) Human (GRCh38)
Location 2:37307133-37307155 2:37307150-37307172
Sequence CCAAAAACGTCTCCAGACATTGC CATTGCCAAATGTTCCCAGGGGG
Strand - +
Off-target summary {0: 10, 1: 262, 2: 703, 3: 1124, 4: 1219} {0: 2, 1: 34, 2: 194, 3: 500, 4: 941}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!