|
Left Crispr |
Right Crispr |
Crispr ID |
928997356 |
928997361 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
2:37307133-37307155
|
2:37307150-37307172
|
Sequence |
CCAAAAACGTCTCCAGACATTGC |
CATTGCCAAATGTTCCCAGGGGG |
Strand |
- |
+ |
Off-target summary |
{0: 10, 1: 262, 2: 703, 3: 1124, 4: 1219} |
{0: 2, 1: 34, 2: 194, 3: 500, 4: 941} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|