ID: 929118514_929118524

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 929118514 929118524
Species Human (GRCh38) Human (GRCh38)
Location 2:38465017-38465039 2:38465046-38465068
Sequence CCCCCTCTCCTTCTCCCATGTAA CATGTAAATAGATGCCTGTATGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 16, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!