ID: 929151436_929151443

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 929151436 929151443
Species Human (GRCh38) Human (GRCh38)
Location 2:38752045-38752067 2:38752089-38752111
Sequence CCCCCTTTATATTGAAATTGTGA CATTTTGGCCAGTGACAATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 263} {0: 1, 1: 0, 2: 1, 3: 12, 4: 258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!