|
Left Crispr |
Right Crispr |
| Crispr ID |
929152738 |
929152741 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:38762013-38762035
|
2:38762038-38762060
|
| Sequence |
CCTCCCGAGTTCAAGAGACTCTT |
TCCTCAGCCTCCCGAGTAGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 20, 2: 673, 3: 10458, 4: 69560} |
{0: 1155, 1: 106565, 2: 292599, 3: 226741, 4: 125901} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|