|
Left Crispr |
Right Crispr |
| Crispr ID |
929152738 |
929152748 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:38762013-38762035
|
2:38762066-38762088
|
| Sequence |
CCTCCCGAGTTCAAGAGACTCTT |
CAGGCACCCGCCACCATGCCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 20, 2: 673, 3: 10458, 4: 69560} |
{0: 2501, 1: 16051, 2: 50860, 3: 101743, 4: 137494} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|