|
Left Crispr |
Right Crispr |
| Crispr ID |
929174659 |
929174662 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:38964113-38964135
|
2:38964156-38964178
|
| Sequence |
CCAATCTACTCTGTAATCTCATT |
AAACCCTGCTTCACAAAGATGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 5, 2: 15, 3: 63, 4: 406} |
{0: 20, 1: 32, 2: 26, 3: 28, 4: 193} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|