ID: 929195474_929195481

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 929195474 929195481
Species Human (GRCh38) Human (GRCh38)
Location 2:39180311-39180333 2:39180362-39180384
Sequence CCACCAGCACAAACATTGTTTTG TGCCTGAGGCTGCCCCAGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 222} {0: 1, 1: 0, 2: 16, 3: 163, 4: 567}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!