ID: 929195642_929195650

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 929195642 929195650
Species Human (GRCh38) Human (GRCh38)
Location 2:39181655-39181677 2:39181679-39181701
Sequence CCCCAACCCAATTACAGTTGGTT CCTTATAAGAAGAGGGAAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 132} {0: 1, 1: 2, 2: 12, 3: 249, 4: 1143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!