ID: 929210999_929211003

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 929210999 929211003
Species Human (GRCh38) Human (GRCh38)
Location 2:39357033-39357055 2:39357060-39357082
Sequence CCTTGTTCCAACTGTGTTATAAT AATGGGACTGTATTTTAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 176} {0: 1, 1: 0, 2: 1, 3: 14, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!