ID: 929216441_929216445

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 929216441 929216445
Species Human (GRCh38) Human (GRCh38)
Location 2:39418572-39418594 2:39418615-39418637
Sequence CCTGGTTAACTAAAAAGCCAGGT GTGATCAAAGTTAACACTGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 790} {0: 1, 1: 1, 2: 5, 3: 13, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!