ID: 929250909_929250913

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 929250909 929250913
Species Human (GRCh38) Human (GRCh38)
Location 2:39754023-39754045 2:39754047-39754069
Sequence CCCTAAAGTGAAAATACATAAAA TGAAGCTGGGAGTGCAACAGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 109, 4: 1038} {0: 1, 1: 0, 2: 0, 3: 17, 4: 300}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!