ID: 929318768_929318776

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 929318768 929318776
Species Human (GRCh38) Human (GRCh38)
Location 2:40514308-40514330 2:40514360-40514382
Sequence CCAGAGAGTAAACTTGAAGCCTG GTGGGCAAACAGAAGGACAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 133} {0: 1, 1: 0, 2: 4, 3: 20, 4: 307}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!