ID: 929320376_929320378

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 929320376 929320378
Species Human (GRCh38) Human (GRCh38)
Location 2:40536874-40536896 2:40536900-40536922
Sequence CCATTTGACGCATTTCAATTTCT TGTGAGCCTGAAAAACAACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 221} {0: 1, 1: 0, 2: 2, 3: 20, 4: 265}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!