ID: 929407205_929407216

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 929407205 929407216
Species Human (GRCh38) Human (GRCh38)
Location 2:41656502-41656524 2:41656551-41656573
Sequence CCCAGTGTTGGAGGTGTTTGGGT CTGCTGTCCTTGCGATAAAGAGG
Strand - +
Off-target summary {0: 2, 1: 7, 2: 9, 3: 27, 4: 176} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!