|
Left Crispr |
Right Crispr |
Crispr ID |
929470078 |
929470081 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
2:42182918-42182940
|
2:42182934-42182956
|
Sequence |
CCAGATTTCCTCTTCTTATAAGG |
TATAAGGATACCAGTTGTATTGG |
Strand |
- |
+ |
Off-target summary |
{0: 9, 1: 140, 2: 478, 3: 958, 4: 1553} |
{0: 2, 1: 27, 2: 116, 3: 723, 4: 1751} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|