ID: 929497024_929497028

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 929497024 929497028
Species Human (GRCh38) Human (GRCh38)
Location 2:42454009-42454031 2:42454061-42454083
Sequence CCAATGAGCATATGAAAAGATGC AATCAGAACCACAATGAGGATGG
Strand - +
Off-target summary {0: 3, 1: 99, 2: 710, 3: 2182, 4: 5296} {0: 1, 1: 0, 2: 18, 3: 93, 4: 317}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!