ID: 929520348_929520354

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 929520348 929520354
Species Human (GRCh38) Human (GRCh38)
Location 2:42644471-42644493 2:42644493-42644515
Sequence CCACCTCGGACTCCCAAAAGTGA ATGCTATTATAGGTGTGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 168, 3: 699, 4: 1798} {0: 1, 1: 0, 2: 0, 3: 9, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!