ID: 929528173_929528180

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 929528173 929528180
Species Human (GRCh38) Human (GRCh38)
Location 2:42725770-42725792 2:42725814-42725836
Sequence CCTGCTCCAGCACTGCAGAATCC ACACAGAGCCAGACAGCAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 349} {0: 1, 1: 0, 2: 2, 3: 48, 4: 455}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!