ID: 929533612_929533616

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 929533612 929533616
Species Human (GRCh38) Human (GRCh38)
Location 2:42767257-42767279 2:42767271-42767293
Sequence CCAGGGGCATGGCATCTGGGCTG TCTGGGCTGAGAAGGGCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 21, 4: 306} {0: 1, 1: 1, 2: 6, 3: 75, 4: 635}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!