ID: 929533612_929533617

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 929533612 929533617
Species Human (GRCh38) Human (GRCh38)
Location 2:42767257-42767279 2:42767272-42767294
Sequence CCAGGGGCATGGCATCTGGGCTG CTGGGCTGAGAAGGGCAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 21, 4: 306} {0: 1, 1: 0, 2: 5, 3: 104, 4: 835}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!