ID: 929557120_929557133

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 929557120 929557133
Species Human (GRCh38) Human (GRCh38)
Location 2:42932384-42932406 2:42932417-42932439
Sequence CCATCGTCCCTCTGTCCCCACTG TGTCTCGGCCTCCCTGAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 48, 4: 480} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!