ID: 929568875_929568885

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 929568875 929568885
Species Human (GRCh38) Human (GRCh38)
Location 2:43007174-43007196 2:43007218-43007240
Sequence CCTCAGAGCCAGGGCTTCTGTGG GAGGACCCACACTGCTTTCTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 35, 4: 382} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!