ID: 929584468_929584486

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 929584468 929584486
Species Human (GRCh38) Human (GRCh38)
Location 2:43105171-43105193 2:43105224-43105246
Sequence CCTGTTGCTACCATGGAGACCTG TGCATTCCTGGCCATAGGGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 9, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!