ID: 929604720_929604736

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 929604720 929604736
Species Human (GRCh38) Human (GRCh38)
Location 2:43226722-43226744 2:43226770-43226792
Sequence CCGCCCGCTCGCGGACGTCAGGC CGCCAATTTTTTTCCTCCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 33} {0: 1, 1: 0, 2: 0, 3: 1, 4: 52}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!