ID: 929604726_929604738

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 929604726 929604738
Species Human (GRCh38) Human (GRCh38)
Location 2:43226750-43226772 2:43226773-43226795
Sequence CCCGGCCTCCCATTGGCCGCCGC CAATTTTTTTCCTCCGGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 171} {0: 1, 1: 1, 2: 0, 3: 8, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!