ID: 929628309_929628312

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 929628309 929628312
Species Human (GRCh38) Human (GRCh38)
Location 2:43433024-43433046 2:43433062-43433084
Sequence CCTAAGAAATCTCTACCTACCTA ATCTTCCTCTAGAAGCTTTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 214} {0: 1, 1: 0, 2: 7, 3: 37, 4: 367}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!