ID: 929646915_929646923

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 929646915 929646923
Species Human (GRCh38) Human (GRCh38)
Location 2:43637332-43637354 2:43637371-43637393
Sequence CCGGGACATCGGGCGCTGCGGCC GATAGACAGGTGAGAAAGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 80} {0: 1, 1: 0, 2: 0, 3: 29, 4: 243}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!