|
Left Crispr |
Right Crispr |
| Crispr ID |
929652203 |
929652207 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:43691576-43691598
|
2:43691601-43691623
|
| Sequence |
CCAGCTTGAAGGTTGGGTTTCAC |
GGGACCTGCCCCATCTGCCTAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 7, 2: 37, 3: 58, 4: 164} |
{0: 4, 1: 18, 2: 24, 3: 44, 4: 299} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|