ID: 929654240_929654245

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 929654240 929654245
Species Human (GRCh38) Human (GRCh38)
Location 2:43714775-43714797 2:43714793-43714815
Sequence CCCATTCCTCAGAGAGCCTCATA TCATAATCTATTAAAAAAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 158} {0: 1, 1: 0, 2: 4, 3: 42, 4: 618}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!