ID: 929734409_929734412

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 929734409 929734412
Species Human (GRCh38) Human (GRCh38)
Location 2:44531391-44531413 2:44531426-44531448
Sequence CCATTTTAAGGACTTCTTTGTAA TTAAGGTTCTTTAAATATCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 81, 4: 2328} {0: 1, 1: 0, 2: 2, 3: 36, 4: 491}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!