ID: 929755532_929755540

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 929755532 929755540
Species Human (GRCh38) Human (GRCh38)
Location 2:44761085-44761107 2:44761104-44761126
Sequence CCCTTGGGGGCAGGGAGTGGAGG GAGGTGGCCAACTGGGGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 53, 4: 552} {0: 1, 1: 0, 2: 2, 3: 36, 4: 422}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!