ID: 929756680_929756683

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 929756680 929756683
Species Human (GRCh38) Human (GRCh38)
Location 2:44771746-44771768 2:44771765-44771787
Sequence CCCAGCTCTGCCTTCTGTCAAGT AAGTGCCTCACAGTTTATAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 46, 4: 412} {0: 1, 1: 0, 2: 1, 3: 11, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!