ID: 929770103_929770115

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 929770103 929770115
Species Human (GRCh38) Human (GRCh38)
Location 2:44884640-44884662 2:44884676-44884698
Sequence CCTCTCCCTCGTACCCTCCTCTC CTGTGACTATGTATGGGAGATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!