ID: 929776259_929776272

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 929776259 929776272
Species Human (GRCh38) Human (GRCh38)
Location 2:44932870-44932892 2:44932917-44932939
Sequence CCTGGCTCTCGATTGCTCCCATC GCGCCCTGGGGCTATGTCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 83} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!