ID: 929784880_929784889

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 929784880 929784889
Species Human (GRCh38) Human (GRCh38)
Location 2:44982267-44982289 2:44982287-44982309
Sequence CCCCACCCCAGAGTTTCTGATTC TTCAGTAAATCTGCTGGGATGGG
Strand - +
Off-target summary {0: 21, 1: 62, 2: 270, 3: 802, 4: 1803} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!