ID: 929784881_929784889

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 929784881 929784889
Species Human (GRCh38) Human (GRCh38)
Location 2:44982268-44982290 2:44982287-44982309
Sequence CCCACCCCAGAGTTTCTGATTCA TTCAGTAAATCTGCTGGGATGGG
Strand - +
Off-target summary {0: 23, 1: 185, 2: 539, 3: 1101, 4: 2226} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!