ID: 929784883_929784889

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 929784883 929784889
Species Human (GRCh38) Human (GRCh38)
Location 2:44982272-44982294 2:44982287-44982309
Sequence CCCCAGAGTTTCTGATTCAGTAA TTCAGTAAATCTGCTGGGATGGG
Strand - +
Off-target summary {0: 18, 1: 161, 2: 463, 3: 902, 4: 1606} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!