ID: 929784885_929784889

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 929784885 929784889
Species Human (GRCh38) Human (GRCh38)
Location 2:44982274-44982296 2:44982287-44982309
Sequence CCAGAGTTTCTGATTCAGTAAAT TTCAGTAAATCTGCTGGGATGGG
Strand - +
Off-target summary {0: 4, 1: 42, 2: 332, 3: 833, 4: 1696} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!