ID: 929824925_929824937

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 929824925 929824937
Species Human (GRCh38) Human (GRCh38)
Location 2:45302641-45302663 2:45302683-45302705
Sequence CCTTGGGCAACCTAATACCCAGG GGGAAGCAGGAAAACCTCCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 25, 4: 292}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!