ID: 929858761_929858763

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 929858761 929858763
Species Human (GRCh38) Human (GRCh38)
Location 2:45657482-45657504 2:45657525-45657547
Sequence CCCTAGTAACTGCTCAATGCATA TATAGCCCCCAAAATGAGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 281} {0: 1, 1: 0, 2: 0, 3: 11, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!